Van Wert City Schools
Van Wert HS
----------
State Report Card
Daily Announcements
Student Grades
Delay Info
Lunch Menu
HS Text Messenging
----------
Student Life
Academics
Clubs
Staff/Faculty
Cougar's Roar
Sports
Channel 6
Picture Page
----------
2010 - 11 Calendar
Bus Rules

Other Local Items
Weather
Niswonger Preforming Arts Center
Vantage Career Center
Times-Bulletin
VW Independent

 

Homework Page for Mrs. Overmyer

09/24/14

>Sequence 1
TCGAAATAACGCGTGTTCTCAACGCGGTCGCGCAGATGCCTTTGCTCATC
AGATGCGACCGCAACCACGTCCGCCGCCTTGTTCGCCGTCCCCGTGCCTC
AACCACCACCACGGTGTCGTCTTCCCCGAACGCGTCCCGGTCAGCCAGCC
TCCACGCGCCGCGCGCGCGGAGTGCCCATTCGGGCCGCAGCTGCGACGGT
GCCGCTCAGATTCTGTGTGGCAGGCGCGTGTTGGAGTCTAAA

>Sequence 2
GTTTATTAGTGATCATGGCTAAGTTTGCGTCCATCATCGCACTTCTTTTT
GCTGCTCTTGTTCTTTTTGCTGCTTTCGAAGCACCAACAATGGTGGAAGC
ACAGAAGTTGTGCGAAAGGCCAAGTGGGACATGGTCAGGAGTCTGTGGAA
ACAATAACGCATGCAAGAATCAGTGCATTAACCTTGAGAAAGCACGACAT
GGATCTTGCAACTATGTCTTCCCAGCTCACAAGTGTATCTGCTACTTTCC
TTGTTAATTTATCGCAAACTCTTTGGTGAATAGTTTTTATGTAATTTACA
CAAAATAAGTCAGTGTCACTATCCATGAGTGATTTTAAGACATGTACCAG
ATATGTTATGTTGGTTCGGTTATACAAATAAAGTTTTATTCACCA

>Sequence 3
CTCGAGACTAGTTCTCTCTCTCTCTCTCTCGTGCCGCATCTCACACCTGT
GGATGGACGGCAGCTGAACCGCGGGAAACTTTCGTTCTCACTCTACCTAG
ATGAACTTTAGTTTATATTAAACACGCGTCGACTCCCACACAAACCGTGC
TCGTTTTACATCTTTGTCTCCGCTTTTGAAAACGAGAAGTTGAATTCGCA
AGACGCAACTTTCCAGCCCCTCACTGAGCGGGCAGAGTCCGTGAAGCGAT
GGAGCCGTCCGTCATTCCCGGTGCTGACATACCCGACCTTTACTCCATTA
ACCCGTTTAATGTCACTTTTCCCGACGACGTTTTGAGTTTCGTTCCTGAT
GGGAGGAACTACACCGAACCTAACCCGGTAAAGAGCCGCG GAATCATCA
TCGCCATTTCCATCACCGCTC

>Sequence 4 
GACATTACGGCGACCCAGTCTCCCCCGGTGTTGTCAGTGGGACTGGGCC
AGACCGCAACCATCACTTGTACGGCCAGTCAAAGCATCTACAGTAACCT
TGCTTGGTACCAGCAGAGAGAAGGACAGAAGCCCTCTCTCCTGATCTAT
GCTGCGACAACGCGATACGAAGGAGTCTCCGAGCGATTCAGCGGCAGTG
GATCAGGGACCAGTTTCACCCTGACAATCAGCAACGTTCAGAATGAGGA
TGTCGCTGACTATTACTGTCAGATCGCATATTCGATCTACTCCGGTTCC
GTTGTTTTCGGTGAAGGAACCAAGCTCAGACTGAGCCGT

>Sequence 5
GAATTCGCGGCCGCATGGGGGAGAAGCTGCCGGTTGTGTATAAACGCTT
CATCTGCTCGTTCCCGGATTGTAATGCCACGTATAACAAGAACCGGAAG
CTGCAGGCCCATCTGTGCAAGCACACGGGGGAGAGACCGTTTCCTTGCA
CATATGAAGGCTGTGAGAAAGGCTTTGTGACGCTGCATCACCTGAATCG
TCATGTGCTCTCCCACACCGGGGAGAAACCCTGCAAATGCGAAACGGAA
AATTGCAATTTGGCGTTCACCACAGCATCCAACATGAGGTTGCACTTCA
AAAGGGCTCATTCTTCTCCGGCGCAGGTCTACGTGTGTTATTTCGCAGA
CTGTGGCCAGCAGTTCAGGAAACATAACCAGCTAAAAATTCACCAGTAT
ATCCATACAAACCAGCAACCCTTCAAAT

>Sequence 6 
GCCCAGCGTCTCTCGGAGGAAGCTAATTCTCAGGTTATCGCAGAGGAATC
TCTTGTAGCTCGTGCTGAGGCTACCGTTGTCCAAGCCGCCGCTCCAACCA
AATCCCTTGATCTGACAACATGGAAGTATGCTGATCTCAGAGACACTATC
AACACCTCAATCGATATTGCGCTCCTGTCAGCCTGCAAGGAGGAGTTCCA
TCGTCGTCTCAAGGTCTACCACGCCTGGAAGATGAAGAATAAGAAGGTTG
CCGCCGGCGACAAGGGCGGACCAGAGAGGGCTCCACAATCCATCTTTGAA
AGTGCCCAACAATACAACCAGCTGGCACCCCCTCCGAAAGCCACCAAGGC
TGCCCCAGCCAATCAGAACATCCAACGCTTCTTCAGGGTGCCTTTCTCCG
TGACTGGGTCCACCGCTCAGGGTCAGATGCCCGAGAGGGGTTGGTGGTAC
GCCCACTTTGACGGTCAGTGGATCGCCCGCCAGATGGAGGTACACCCCAC
CAAGGTCCCCGTTCTTCTGGTTGCAGGTAAAGATGATGAGAACATGTGTG
AGATGAGTTTGGAGGAGACTGGGTTGACACGACGTCCCAACGCCGAGATC
GTCGAGCGGGAGTTTGAGGAGCCCTGGAAGCGTAGCGGCGGTCAGCAGTA
CCACATGGCTGCAGTACGCAACAAGCAGGCTAGACCAACGTGGGCCACGC
AGAGCTTGAA

>Sequence 7
AACAATTCATTTTTCCTGCTTTCCTAGAAAATTCTATAAAAGCTTCAAAA
TGAATTACTTGGTGATGATTAGTTTGGCACTTCTCTTCGTGACAGGTGTA
GAGAGTGTAAAAGACGGTTATATTGTCGACGATGTAAACTGCACATACTT
TTGTGGTAGAAATGCATACTGCAACGAGGAATGTACCAAGTTGAAAGGTG
AGAGTGGTTATTGCCAATGGGCAAGTCCATATGGAAACGCCTGTTATTGC
TATAAATTGCCCGATCATGTACGTACTAAAGGACCAGGAAGATGCCATGG
CCGATAAATTATAAGATGGAATGTATCCTAAGTATCAATGTTAAATAAAT
ATAATCAAAAAATT

>Sequence 8
ACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGG
GAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGAT
GGCGCAGGGGATCAAGATCTGATCAAGAGACAGGATGAGGATCGTTTCGC
ATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGA
GAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATG
CCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAG
ACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCT
ATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTG
TCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAG
GATCTCCTGTCATCTCACCTTGCTCCTGCC

>Sequence 9
TCTTGGTGAGGATCCGTTGAGAACAACCCAACCGCCGCCCCATCGCCCTN
GTTAGANTNATGGCCGCGTCGGCGCTGCACCAGACCACCAGCTTCCTCNG
CACCGCCCCTCGCCGGGATGAGCTCGTCCGCCGCGTCGGCGACTCCGGTG
GCCGCATCACCATGCGCCGCACCGTCAAGAGCGCGCCCCAGAGCATCTGG
TATGGACCTGACCGTCCCAAGTNCCTGGGCCCGTTCTCGGAGCAGACGCC
ATCGTACCTGACCGGAGAGTTCCCGGGAGACTACGGGTGGGACACGGCGG
GGCTATCGGCCGACCCGGANACGTTCGCTATGAACAGGGAGCTGGANGTG
ATCCACTCNCGGTGGGCGATGCTGGGGGCGCTGGGCTGCGTCTTCCCGGA
GATCCTGTCCAANAACGGGG

>Sequence 10
AGAACTACCAAGATGCTGCTCAGGTCAGAGATTGTCGTCTGTCTGGCCTT
CTGGATCTTGCACTTGAGAAAGATTATGTTCGAACCAAGGTGGCTGACTA
TATGAACCATCTCATTGACATTGGCGTACAGGGTTCAGACTTGATGCTTC
TAAGCACATGTGGCCTGGAGACATAAAGGCAATTTTGGACAAACTGCATA
ATCTCAATACAAAATGGTTCTCCCAAGGAAGCAGACCTTTCATTTTCCAA
GAGGTGATTGATCTGGGTGGTGAGGCAGTGTCAAGTAATGAGTATTTTGG
AAATGGCCGTGTGACAGAATTCAAATATGGAGCAAAATTGGGCAAAGTTA
TGCGCAAGTGGGATGGAGAAAAGATGTCCTACTTAAAGAACTGGGGAGAA
GGTTGGGGTTTGATGCCTTC

>Sequence 11
TGCATCACAAGGTTAATGTGAAAACACAGCGAGAAGTCCATTTCCCAATG
GACCTCTTGCAAGCCTGTGGTGCATCTGCCCCTAGGCCAGTTGCCCGTGT
TTCACGTGCAACCGACCTAGACCGACGCTACAGGTGCGTCCTCAGTTTAC
CTGAGGAGCGTGCTCGCAGTGTTGGGTGTAAATGGTCGTCGACCCGAGCG
GCGTTACGACGTGGACTCGAGGAGCTTGGCTCCCGCGAGTTCCGCCGTCG
TCTCCGTTTGGCGGACGATTGCTGGCGCGCGATCTGCGCGGCCGTCTGCA
CGGGTCGGAAGTTTCCTTCCTTCTCGGTGACAGATCGGCCGGCAAGAGCT
CGCCTTGCAAAAGTCTACCGTATGGGTCGTCGACTGCTAGTAGGTGTGGT
CTGCCGAGGCGAATCGGTCG

>Sequence 12
ATAACCACACGCCTTTGGCGTGATTATCAGCTTTCAAGTTTCAGTTACTA
AAACTAATACTGACTATAAAACAGAAGCAAAAAAATTTTCGATTTTTATG
AAAACGGTCGCAAAGAAGTTAGCAAAAATATATAATTTCTTTTGAAATTG
TTCACTTGGCCAAGCTGCAGTTTCAATATTTTAATAAAGGGGGCAGTAAA
AAGTGAAAAAAAAGAAAAGTTTCTGGCTTGTTTCTTTTTTAGTTATAGTA
GCTAGTGTTTTCTTTATATCTTTTGGATTTAGCAATCATTCTAAACAAGT
TGCTCAAGCGGCTAGTGATACGACATCAACTGATCACTCAAGCAATGATA
CAGCTGATTCTGTTAGCGACGGTGTTATTTTGCATGCATGGTGCTGGTCG
TTCAACACGATTAAAAACAACTTGAAACAGATTCATGACGCCGGCTACAC
AGCGGTTCAAACTTCACCTGTTAATGAAGTTAAAGTTGGAAATAGCGGGT
CTAAGTCATTAAATAACTGGTATTGGCTATATCAGCCAAC

>Sequence 13
GTGCGCGTTAGACCATATAAAGAAAAACCAATACAAACTCCAGCAAAATC
TGTTGATATAAGATATACTGTACAGTTTACTCCTTTAAACCCTGATGATG
ATTTCAAGCCAGTTCTCAAAGATACTAAACTATTGAAAACATTAGCTATC
GGCGACACCATCACATCCCAAGAATTACTAGCTCAAGCACAAAGCATTTT
AATCGAAAGCCATCCAGATTATACGATTTATGAACGTGATTCCTCAATCG
TCACTCATGACAATGACATTTTCCGTACGATTTTACCAACGGATCAAGAG
TTTACTTACCATGTCAAAAATCGGGAACAAGCTTATAAGGCCAATTCTAA
AACAGATATTAAAGAAAAAACGAACAACACCGAC

>Sequence 14
CTAATAATCCTTGGAATACTCCTATATTTTGTATAAAGAAGAAATCAGGG
AAATGGAGAATGCTAATTGATTTTAGAGAACTTAATGCAAAAACAGAAAA
AGGAGCAGAAGTCCAATTAGGATTACCTCACCCATCTGGATTACAGAAGA
GAAAGAATGTAACAGTTTTAGATATAGGAGATGCTTATTTTACCATCCCT
TTAGATCCTGATTATCAGCCCTATACTGCATTTACTTTACCATCTAAGAA
TAATCAAAGTCCAGGAAAAAGGTATATTTGGAAATCTCTTCCACAGGGGT
GGGTCTTGAGTCCCTTAATATACCAGAGCACTCTAGATAATATTCTACAA
CCATTTAGAA

>Sequence 15
ATGTTTTCCGGTGGCGGCGGCCCGCTGTCCCCCGGAGGAAAGTCGGCGGC
CAGGGCGGCGTCCGGGTTTTTTGCGCCCGCCGGCCCTCGCGGAGCCGGCC
GGGGACCCCCGCCTTGCTTGAGGCAAAACTTTTACAACCCCTACCTCGCC
CCAGTCGGGACGCAACAGAAGCCGACCGGGCCAACCCAGCGCCATACGTA
CTATAGCGAATGCGATGAATTTCGATTCATCGCCCCGCGGGTGCTGGACG
AGGATGCCCCCCCGGAGAAGCGCGCCGGGGTGCACGACGGTCACCTCAAG
CGCGCCCCCAAGGTGTACTGCGGGGGGGACGAGCGCGACGTCCTCCGCGT
CGGGTCGGGCGGCTTCTGGCCGCGGCGCTCGCGCCTGTGGGGCGGCGTGG
ACCACGCCCCGGCGGGGTTCAACCCCACCGTCACCGTCTTTCACGTGTAC
GACATCCTGGAGAACGTGGAGCACGCGTAC

>Sequence 16
CTCGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGGATCTGCCCGA
TAGAGGGGGATAACCACTGGAAACGGTGGCTAATACCGTATAACGTCGCR
AGACCAAAGAGGGGGACCTTCGGGCCTCTCACTATCGGATGAACCCAKAT
GGGATTAGCTAGTRSGCGGGGTMACGGGCCCACCTAGGCGACKATCCCTA
GCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGASACACGGYCCASA
CTCCTACGGGRGGCAGCAGKGGGGAATATTGCACARTGGGCGCAMGCCTG
ATGCASCCATGCCGYGTGTATGAAGARGGCCTTCGGGTTGTAAAGTWCTT
TCAGCGGGGAGGAAGGCKATGTGGTTAATAACCGCVTYGATTGACGTTAC
CCGCAGAAGAAGCACCGKCTAACTCCGTGCCAGCAGCCGCGGTWATACGG
AGGG

 
03/31/14

BioMed:  Videos  4/1/14

http://youtu.be/46Xh7OFkkCE  (CancerQuest video)

 http://www.learner.org/courses/biology/archive/animations/hires/a_cancer2_h.html

http://www.learner.org/courses/biology/archive/animations/hires/a_cancer3_h.html

 
02/07/14

Anatomy & Physiology:  The Muscular System

 

Video 1: Action potential 1 http://www.youtube.com/watch?v=Iiiz5CpFCQo
 
Video 2:   Action potential  2   http://www.youtube.com/watch?v=hqynCsign8E
 
Video 3: Cross Bridge cycle   http://www.youtube.com/watch?v=Ct8AbZn_A8A
 
Video 4: Excitation Contraction Coupling    http://www.youtube.com/watch?v=8wa04qYsaps
 
12/12/13

http://www.heromachine.com/heromachine-2-5-character-portrait-creator/

 
11/22/13
 LoggerPro examples folder
 
11/04/13
 1.3.1 Good Vibrations

o  iKnowthat.com – Science Lab Sound Waves http://www.iknowthat.com/ScienceIllustrations/sound/science_desk.swf.

o 
Partners in Assistive Technology Training and Services - The Ear: Auditory and Vestibular Systems http://webschoolsolutions.com/patts/systems/ear.htm

o  Wisconsin Online Learning Center – Anatomy of the Ear http://www.wisc-online.com/objects/index_tj.asp?objID=AP1502

o  Augustana College – Virtual Tour of the Ear http://ctl.augie.edu/perry/ear/hearmech.htm

o 
Hear-it.org – Impression of Hearing Impairment http://www.press.hear-it.org/Impression-of-hearing-impairment-1
 
09/25/13
Anthony:  

cgcgtttatc ttgcccgggc tcaacctttc agaaagcact cctaattagc cctcatagat

 tcggagaaac caaaggaaac tcagctccct tgataataag ggaacctttt attgcttgtg

gaccaaatga atgcaaacac tttgctctaa cccattatgc agcccaacca gggggatact

acaatggaac aagaggagac agaaacaagc tgaggcatct aatttcagtc aaattgggca


Wanda

ttgtggcggc atcatgtttt tggcatgtgt acttgtcctt atcgtcgacg ctgttttgca

gctgagtccc ctccttggag ctgtaactgt ggtttccatg acgctgctgc tactggcttt

cgtcctctgg ctctcttcgc cagggggcct aggtactctt ggtgcagccc ttttaacgtt

ggcagcaggt aagccacacg tgtgacattg cttgcctttt tgccacatgt tttctggaca

caggactaac catgccatct ctgattatag ctctggcact gctagcgtca ctgattttgg

gcacacttaa cttgactaca atgttccttc

Maggie:
atgaatatta gaaataagat tgaaaatagt aaaacactac tatttacatc ccttgtagcc

gtggctctac taggagctac acaaccagtt tcagccgaaa cgtatacatc acgcaatttt

gactggtctg gagatgactg gcctgaagat gactggtctg gagatggttt gtctaaatat


Arnie:
agcagaagca gagcatcttc tcaaaactga ggcaaatagg ccaaaaatga acaatgctac

cttcaactat acaaacgtta accctatttc tcacatcagg gggagtatta ttatcactat

atgtgtcagc ttcattgtca tacttactat attcggatat attgctaaaa ttttcaccaa

cagaaataac tgcaccaaca atgccattgg attgtgcaaa cgcatcaaat gttcaggctg

tgaaccgttc tgcaacaaaa ggggtgacac ttcttctccc agaaccggag tggacatacc

 
09/04/13
BMI: Using DNA to Identify Pathogens

Sequence data from Sue's sample:

atgacccgtc aatctctgca acaggctgcc gaaagccgcc gttccattta ttcgttaaat
aaaaatctgc ccgtcggcaa agatgaaatc gtccaaatcg tcgaacacgc cgttttgcac
acaccttctt cgttcaattc ccaatctgcc cgtgtggtcg tgctgtttgg cgaagagcat

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 


High School
Staff Pages
   Mr. Clifton    7/12
   Mr. Aufderhaar    3/26
   Mrs. Baer    3/17  
   Mr. Butler    11/14
   Mrs. Hamrick    8/24
   Mr. Hood    8/24
   Mrs. Howell    8/24
   Mr. Kallas    8/21
   Mr. Kitson     
   Mrs. Kramer    3/19  
   Mrs. Krites    11/23  
   Miss LaRue    2/10  
   Mr. Neal    11/6
   Mrs. Overmyer    10/13  
   Mr. Parrish     
   Mrs. Reichert    11/19
   Mr. Rollins    9/13  
   Mr. Scott    5/23  
   Mr. Utendorf     
   Mrs. Van Horn    8/26
   Mrs. Wilhelm     
 

Maintained by the VWHS Web Design Class